{"lab": {"correspondence": [{"contact_email": "dmFoZWRpQHBlbm5tZWRpY2luZS51cGVubi5lZHU=", "@id": "/users/a44efbbf-7993-4258-b1ed-88045387e8ba/", "display_title": "Golnaz Vahedi"}], "display_title": "Golnaz Vahedi, UPENN", "status": "current", "uuid": "fedfc81d-f1ce-4203-9c87-bc0b6eb2bfc3", "@id": "/labs/golnaz-vahedi-lab/", "@type": ["Lab", "Item"], "title": "Golnaz Vahedi, UPENN", "pi": {"error": "no view permissions"}, "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin", "role.lab_submitter", "submits_for.fedfc81d-f1ce-4203-9c87-bc0b6eb2bfc3"]}}, "award": {"status": "current", "display_title": "SINGLE-CELL DISSECTION OF CHROMATIN ARCHITECTURE MECHANISMS CONNECTING PATHOLOGIC INSTABILITY AND TRANSCRIPTIONAL SILENCING", "@type": ["Award", "Item"], "name": "1U01DA052715-01", "project": "4DN", "uuid": "8c9d595e-2809-4779-ae6e-305341f695ff", "@id": "/awards/1U01DA052715-01/", "center_title": "OFHHD - Phillips-Cremins", "description": "OFHHD: Short tandem repeat regions (STR) are distributed evenly across the human genome, and recent genome-wide studies have demonstrated that STRs are polymorphic across individuals and linked to gene expression levels. STR instability at key genomic loci has been causally linked to disease pathophysiology in a range of expansion disorders. We recently demonstrated that nearly all disease-associated STRs co-localize with boundaries demarcating topologically associated domains (TADs). Moreover, we have observed that pathologic STR instability and transcriptional silencing can destroy the associated boundary and shift genomic loci to the nuclear periphery. These results now open critical unanswered questions regarding whether and how STR expansion and pathologic alterations in gene expression are functionally linked to boundary integrity and radial positioning. Here, we focus on the prototypic repeat expansion disorder Friedreich\u2019s ataxia (FRDA) in which expansion of a GAA STR in the first intron of the FRATAXIN (FXN) gene results in cardiac and neuronal pathology. The cardiac pathology, specifically hypertrophy, fibrosis, and occasional dilation of the ventricle, is the etiology of significant FRDA mortality. GAA expansion is associated with the silencing of FXN transcription and a repositioning of the locus to the nuclear periphery. However, it remains unclear if the change in genome folding, radial positioning, or reduced expression drives STR expansion or vice versa. A major technical barrier contributing to this knowledge gap is that STR instability and genome folding are classically evaluated in bulk populations, however they exhibit tremendous variation across individual somatic cells of the same subtype and among cell types within a pathologically affected tissue. Here, we seek to decipher the causal link among STR instability, transcription, radial positioning, and genome folding. Our central hypothesis is that disruption of long-range loops is the initial event triggered by STR expansion leading to a cascade of heterochromatin spreading, silencing, and loss of radial positioning. We will test our hypothesis by generating genome-wide, single-cell maps of chromatin accessibility, expression, and the repressive H3K9me3 heterochromatin mark in GAA-expanded and control iPS cells and iPS-derived cardiomyocytes. We will integrate genomics data with single-cell sequential Oligopaints/OligoSTORM imaging of TADs and local chromatin structure, as well as single molecule RNA FISH for FXN expression. We will implement multiple genome engineering strategies, including dCas9-VP64 FXN activation and dCas9-CTCF loop re-engineering in FRDA GAA-iPS cells, and dCas9-Krab-Dnmt3a FXN silencing and dCas9-Krab CTCF-mediated loop disruption in healthy iPS cells. We will assay the effect of genome engineering approaches on TADs, radial positioning, STR length, and FXN expression in single cells. Successful completion of the proposed work will shed light on the pathophysiological mechanisms underlying repeat expansion disorders by deciphering the cause-and-effect relationships among genome folding, radial positioning, transcription, and STR expansion.", "pi": {"error": "no view permissions"}, "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}, "status": "released", "aliases": ["golnaz-vahedi-lab:tcf1_KO"], "constructs": [{"name": "TCF1-MSCV-Cas9-puro", "status": "released", "construct_type": "crispr construct", "designed_to_target": "TCF-1", "display_title": "TCF1-MSCV-Cas9-puro", "@id": "/constructs/8d8c0bf2-4b91-48d4-94fb-dd3d173d70b6/", "@type": ["Construct", "Item"], "uuid": "8d8c0bf2-4b91-48d4-94fb-dd3d173d70b6", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}, {"name": "TCF1-pSL21-vex", "status": "released", "construct_type": "crispr construct", "designed_to_target": "TCF-1", "display_title": "TCF1-pSL21-vex", "@id": "/constructs/f6e1cf82-bf68-4834-b0a6-8d1a5ee1ee32/", "@type": ["Construct", "Item"], "uuid": "f6e1cf82-bf68-4834-b0a6-8d1a5ee1ee32", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}], "guide_rnas": ["ACCGCAACCAGATCCTGGGTCGCA", "AAACTGCGACCCAGGATCTGGTTG"], "description": "Crispr induced TCF-1-knockout", "date_created": "2022-10-13T15:34:14.899519+00:00", "submitted_by": {"error": "no view permissions"}, "last_modified": {"modified_by": {"error": "no view permissions"}, "date_modified": "2022-12-12T22:24:37.699629+00:00"}, "target_of_mod": [{"display_title": "TCF-1 mouse gene", "uuid": "bc5c640a-6828-451a-8fe6-b096de9737e3", "@id": "/bio-features/bc5c640a-6828-451a-8fe6-b096de9737e3/", "status": "released", "@type": ["BioFeature", "Item"], "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}], "genomic_change": "deletion", "public_release": "2022-12-12", "schema_version": "2", "project_release": "2022-12-12", "modification_type": "Crispr", "@id": "/modifications/6a6a5108-d18b-4ec9-ad77-d224a7f06fda/", "@type": ["Modification", "Item"], "uuid": "6a6a5108-d18b-4ec9-ad77-d224a7f06fda", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}, "display_title": "Crispr deletion for TCF-1 mouse gene", "external_references": [], "modification_name": "Crispr deletion for TCF-1 mouse gene", "modification_name_short": "TCF-1 deletion", "@context": "/terms/", "aggregated-items": {}, "validation-errors": []}