{"lab": {"uuid": "00073229-0955-47af-ab67-6abf4880cb2c", "display_title": "Gerd Blobel, CHOP", "status": "current", "correspondence": [{"contact_email": "YmxvYmVsQGVtYWlsLmNob3AuZWR1", "@id": "/users/9dcbdd0c-634c-4ec6-b6dc-89efd542c203/", "display_title": "Gerd Blobel"}], "title": "Gerd Blobel, CHOP", "@type": ["Lab", "Item"], "@id": "/labs/gerd-blobel-lab/", "pi": {"error": "no view permissions"}, "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin", "role.lab_submitter", "submits_for.00073229-0955-47af-ab67-6abf4880cb2c"]}}, "award": {"name": "1U01HL129998-01", "center_title": "NT - Raj", "uuid": "cf0c686c-a3ad-411d-9986-ad42927352c0", "status": "current", "description": "NT: Critical unanswered questions in the field of genome biology are how the dynamics of chromatin folding shape gene expression patterns. Our knowledge of the dynamics of higher-order 3-D folding of chromatin is severely limited, largely due to the lack of technologies to precisely image, engineer and monitor looping in a precise spatiotemporal manner across a population of cells. Here we propose to address these limitations by developing tools to dynamically alter chromatin folding in a synchronous manner across populations of cells as well as individual cells, and measure chromatin looping and its relationship to transcription at high spatial resolution in single cells. In Specific Aim 1 we will design tools to control looping dynamics. We will modify factors that fold chromatin at various levels, such as Ldb1 and CTCF by fusion to a moiety whose stability can be controlled by diffusible ligands. In combination with hi resolution 5C and single molecule imaging these tools are expected to generate fundamental insights into the relationship of nuclear architecture and gene expression mechanisms. In Specific Aim 2 we plan to engineer light-inducible systems for the precise control of looping dynamics. Using light activated dimerization domains that can be used in conjunction with designer DNA binding proteins we attempt to engineer factors used to rapidly promote or disrupt chromatin looping at various scales. This technology should enable studies not only in populations but also at the single cell level. In Specific Aim 3: we will develp reagents to study the transcriptional dynamics in relation to looping at the single cell level. We will combine RNA FISH with super-resolution imaging to develop a methodology for exploring the spatial and temporal structure of nascent transcription at high resolution. Combined with high-throughput image acquisition, we will discriminate the temporal dynamics of transcription by measuring the relative intensities arising from the different parts of the transcript. We will employ super-resolution imaging (STORM) to measure the spatial structure of transcription sites. These experiments are expected to reveal the impact of forced chromatin looping on distinct stages of the transcription cycle and elucidate the relationship between transcriptional burst kinetics and physical gene structure.", "@type": ["Award", "Item"], "@id": "/awards/1U01HL129998-01/", "project": "4DN", "display_title": "ENGINEERING AND VISUALIZING GENOME FOLDING AT HIGH SPATIOTEMPORAL RESOLUTION", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}, "pi": {"error": "no view permissions"}}, "notes": "Old Target: 0195db80-bb75-4327-abdc-e654db459251", "status": "released", "aliases": ["4dn-dcic-lab:Slc25a37-E1-3-deletion"], "guide_rnas": ["TCTCTTGGTGTTGCCGAAGA", "TATAGGGCCTGAGCTGAGTT", "ATTTGTGGACTCAATGAACC", "ATTCTATAGTGTGTCCTCTA"], "description": "Deletion of Slc25a37 enhancers E1 - E3", "date_created": "2018-08-31T18:00:59.650949+00:00", "submitted_by": {"error": "no view permissions"}, "last_modified": {"modified_by": {"error": "no view permissions"}, "date_modified": "2019-07-09T17:18:01.536260+00:00"}, "target_of_mod": [{"status": "released", "display_title": "Slc25a37 enhancers E1-3 mouse region", "@id": "/bio-features/453c37fc-ad86-4cbc-af3b-c0aa68174b57/", "uuid": "453c37fc-ad86-4cbc-af3b-c0aa68174b57", "@type": ["BioFeature", "Item"], "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}], "genomic_change": "deletion", "public_release": "2018-10-24", "schema_version": "2", "project_release": "2018-10-24", "modification_type": "Crispr", "override_modification_name": "Crispr deletion of Slc25a37 enhancers E1-3", "@id": "/modifications/4dad1144-32d1-465e-9b55-5ea400486737/", "@type": ["Modification", "Item"], "uuid": "4dad1144-32d1-465e-9b55-5ea400486737", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}, "display_title": "Crispr deletion of Slc25a37 enhancers E1-3", "external_references": [], "modification_name": "Crispr deletion of Slc25a37 enhancers E1-3", "modification_name_short": "Crispr deletion of Slc25a37 enhancers E1-3", "@context": "/terms/", "aggregated-items": {}, "validation-errors": []}