{"lab": {"title": "Alistair Boettiger, STANFORD", "display_title": "Alistair Boettiger, STANFORD", "status": "current", "@type": ["Lab", "Item"], "uuid": "312cb909-76a6-405d-a96c-c3292abf08a1", "@id": "/labs/alistair-boettiger-lab/", "correspondence": [{"contact_email": "YWJvZXR0aWdAc3RhbmZvcmQuZWR1", "@id": "/users/b8835c78-05e3-4173-a6c5-1ab93b4d12cc/", "display_title": "Alistair Boettiger"}], "pi": {"error": "no view permissions"}, "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin", "role.lab_submitter", "submits_for.312cb909-76a6-405d-a96c-c3292abf08a1"]}}, "award": {"@id": "/awards/1U01DK127419-01/", "display_title": "LIVE-CELL MULTIPLEX SUPER-RESOLUTION IMAGING OF CHROMATIN STATE TRANSITIONS", "uuid": "b7c5d0c8-053e-4da3-b446-b68787a5a738", "status": "current", "description": "RT-CDF: Chromatin structure and transcription regulation are essential for cellular function, and their dynamics are highly correlated both in development and in disease. However, despite decades of amazing work identifying the molecular players involved in these processes, and mapping their interactions genome-wide, we are currently unable to describe the function connecting 3D chromatin structure and transcription dynamics. This limitation stems from the fact that chromatin structure and gene expression emerge from intrinsically stochastic transitions at the single-cell level, and we are missing the critical temporal parameters associated with these transitions. Therefore, new tools to measure both chromatin structure and transcription over time in single cells are critical for understanding how the human genome is read and for predictively controlling the epigenome.  Here, we propose to develop a new set of live single-cell imaging technologies to simultaneously measure changes in 3D chromatin structures and their associated dynamics of gene expression across a large range of timescales: from dynamics of individual topologically associated domains and enhancer-promoter interactions, to changes associated with stable epigenetic memory across cell cycles. For the shorter timescales (under a cell cycle), our new imaging approach combines live super-resolution microscopy of fluorescently labeled loci with end-point demultiplexing of loci identity using Optical Reconstruction of Chromatin Architecture (ORCA), in order to track and trace 3-12 points within a functional chromatin unit. This new technique, which we call live-ORCA, will allow us to measure for the first time the temporal dynamics of an entire topologically associated domain in single cells. We will use live-ORCA in conjunction with time-lapse imaging of transcriptional bursting to study the dynamics of promoter-enhancer activity throughout cell differentiation and under perturbations of the chromatin network. For the longer timescale (across multiple cell cycles), our approach will combine time-lapse microscopy of gene expression, monitoring the distance between two tagged genomic loci as a live reporter of chromatin structure, and end-point chromatin tracing of the entire gene neighborhood using ORCA. We will perform these measurements in two systems: at a highly controlled synthetic reporter where we can induce either short-term silencing or long-term epigenetic memory, and at time points in differentiation when genes commit epigenetically to a new transcriptional state. Moreover, in order to further investigate the mechanism of epigenetic inheritance, we will develop a novel microfluidic device that allows us to track changes in chromatin 3D structures across individual cell lineages. Finally, to test our quantitative understanding, we will go back and forth between these single-cell data and theoretical modelling of chromatin dynamics. This research plan will greatly advance our understanding of chromatin dynamics and its functional role in transcription regulation, while at the same time contributing a whole new set of novel imaging technologies and engineered cell lines that will serve as a jumping board for the 4D Nucleome and broader scientific community.", "center_title": "Bintu", "name": "1U01DK127419-01", "@type": ["Award", "Item"], "project": "4DN", "pi": {"error": "no view permissions"}, "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}, "status": "released", "aliases": ["alistair-boettiger-lab:mod_dTAG-Ring1b"], "guide_rnas": ["TTTATTCCTAGAAATGTCTC"], "description": "Homozygous insertion of dTAG at the N-terminus of Ring1b", "date_created": "2023-01-24T12:43:52.786866+00:00", "submitted_by": {"error": "no view permissions"}, "last_modified": {"modified_by": {"error": "no view permissions"}, "date_modified": "2023-04-13T20:17:41.322166+00:00"}, "target_of_mod": [{"uuid": "1bf49605-6f4a-45f6-a634-65cc423f0fc6", "status": "released", "@type": ["BioFeature", "Item"], "display_title": "Rnf2 mouse gene", "@id": "/bio-features/1bf49605-6f4a-45f6-a634-65cc423f0fc6/", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}], "genomic_change": "insertion", "public_release": "2023-04-13", "schema_version": "2", "project_release": "2023-04-13", "modification_type": "Crispr", "override_modification_name": "dTAG-Ring1b", "@id": "/modifications/37eebc51-9b31-4758-b41b-2e9dd5573ad3/", "@type": ["Modification", "Item"], "uuid": "37eebc51-9b31-4758-b41b-2e9dd5573ad3", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}, "display_title": "dTAG-Ring1b", "external_references": [], "modification_name": "dTAG-Ring1b", "modification_name_short": "dTAG-Ring1b", "@context": "/terms/", "aggregated-items": {}, "validation-errors": []}