{"lab": {"uuid": "4dfac8f5-a868-4b29-9c11-a0932130e121", "status": "current", "@type": ["Lab", "Item"], "correspondence": [{"contact_email": "YmVub2l0LmJydW5lYXVAZ2xhZHN0b25lLnVjc2YuZWR1", "@id": "/users/c015dffd-4ca1-4070-905f-8a04b3754b2b/", "display_title": "Benoit Bruneau"}], "title": "Benoit Bruneau, UCSF", "display_title": "Benoit Bruneau, UCSF", "@id": "/labs/benoit-bruneau-lab/", "pi": {"error": "no view permissions"}, "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin", "role.lab_submitter", "submits_for.4dfac8f5-a868-4b29-9c11-a0932130e121"]}}, "award": {"display_title": "GENETIC DETERMINANTS OF 4D GENOME FOLDING IN HUMAN CARDIAC DEVELOPMENT", "uuid": "f910add4-950f-4e01-b9ea-6d88bfd3af99", "status": "current", "@type": ["Award", "Item"], "center_title": "Bruneau", "@id": "/awards/1U01HL157989-01/", "project": "4DN", "description": "RT-CDF: A major unanswered question is how chromatin topology coordinates human development and cellular differentiation, and how genome folding is differentially regulated in human disease. It is thought that three- dimensional (3D) chromatin organization is driven by transcriptional regulators, but fundamental mechanisms of this regulation as it relates to disease-relevant human cells have not been well explored. We propose to elucidate the temporally dynamic 3D nucleome (4DN) that underlies human cardiac differentiation, its molecular underpinnings, and the impact of mutations that underly defective 4DN organization in human congenital heart disease (CHD). CHDs are the most common birth defect and arise from abnormal heart development. The genetic basis of CHD is largely mutations in genes encoding chromatin modifiers (e.g. WDR5, KMT2D) and transcription factors (TFs, e.g. TBX5, GATA4), many of which also cause adult-onset arrhythmias. The impact of CHD mutations on the 4DN has not been explored. We hypothesize that 3D genome folding is highly regulated during cardiac differentiation and is impacted by disease-causing mutations in transcriptional regulators and non-coding elements. We will use iPS cell models and machine learning to elucidate dynamic 3D chromatin organization in human cardiomyocytes and endothelial cells during normal and diseased cardiac differentiation. We propose 3 specific aims: Aim 1: Establish a kilobase-scale 4D map of genome folding in human cardiomyocytes (CM) and endothelial cell (EC) differentiation. We will use directed differentiation of human iPS cells towards the two major cell types of the developing heart: CMs and ECs, and using microC across a fine time course of differentiation we will define at kilobase scale the 3D organization of the genome, capturing the states of developmental intermediates and the final differentiated cells. This aim will generate an essential integrated 4DN template for discovery in cardiac differentiation. In Aim 2: we will Determine the regulatory and disease-related basis for cardiac 3D chromatin organization. We will perform microC in iPS cell lines with CHD-associated mutations in transcriptional regulators, differentiated into CMs and ECs. These findings will establish the degree to which CHD is caused by abnormal genome folding and chromatin states, with important relevance to other human cardiovascular diseases. Finally, Aim 3 will address High-throughput screening of millions of CHD and synthetic non- coding mutations with a deep-learning model of dynamic genome folding. We will build a deep-learning model predicting 3D chromatin contact frequencies across cardiac differentiation at kilobase-resolution. By introducing thousands of CHD patient deletions and other non-coding mutations in silico, we will prioritize variants likely to interact with transcriptional regulators to cause disease through disrupted genome folding. Several candidates will be validated in engineered iPS cells differentiated into CMs and ECs. These results will provide a novel platform for computational discovery of disease variant impact across diverse human diseases", "name": "1U01HL157989-01", "pi": {"error": "no view permissions"}, "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}, "status": "released", "aliases": ["bruneau-lab:FKBP12F36V-NIPBL-dtag"], "created_by": {"status": "released", "@type": ["Vendor", "Item"], "@id": "/vendors/bruneau-lab/", "display_title": "Bruneau Lab", "uuid": "1f565fb2-570b-46b4-b59b-168270bea3c8", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}, "guide_rnas": ["GCCCTCGTCTGCGTCGGCCA"], "description": "N-terminal integration of FKBP12(F36V) tag  with 2X HA to TBX5 using Crispr", "date_created": "2025-10-16T15:16:33.704610+00:00", "submitted_by": {"error": "no view permissions"}, "last_modified": {"modified_by": {"error": "no view permissions"}, "date_modified": "2026-04-23T20:12:12.771547+00:00"}, "target_of_mod": [{"@type": ["BioFeature", "Item"], "status": "released", "@id": "/bio-features/ac958a19-6717-46e3-9409-27cd361fbb94/", "uuid": "ac958a19-6717-46e3-9409-27cd361fbb94", "display_title": "TBX5 gene", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}], "genomic_change": "insertion", "public_release": "2026-04-23", "schema_version": "2", "project_release": "2026-04-23", "contributing_labs": [{"display_title": "Katherine Pollard, UCSF", "@type": ["Lab", "Item"], "status": "current", "@id": "/labs/katherine-pollard-lab/", "correspondence": [{"contact_email": "a2F0aGVyaW5lLnBvbGxhcmRAZ2xhZHN0b25lLnVjc2YuZWR1", "@id": "/users/9b476d96-70d4-4eae-b12f-c0f55d849831/", "display_title": "Katherine Pollard"}], "uuid": "bae16ec7-6e90-48ec-ba27-fa4f6510489c", "pi": {"error": "no view permissions"}, "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin", "role.lab_submitter", "submits_for.bae16ec7-6e90-48ec-ba27-fa4f6510489c"]}}], "modification_type": "Crispr", "@id": "/modifications/0987df2d-c03a-47f9-85bf-2fd55937d765/", "@type": ["Modification", "Item"], "uuid": "0987df2d-c03a-47f9-85bf-2fd55937d765", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}, "display_title": "Crispr insertion for TBX5 gene", "external_references": [], "modification_name": "Crispr insertion for TBX5 gene", "modification_name_short": "TBX5 insertion", "@context": "/terms/", "aggregated-items": {}, "validation-errors": []}