{"lab": {"title": "Tomoko Yamada, NW", "status": "current", "uuid": "4e87e04c-6a49-4a71-8240-5fdae2f04b24", "correspondence": [{"contact_email": "dG9tb2tvLnlhbWFkYUBub3J0aHdlc3Rlcm4uZWR1", "@id": "/users/3b5a8696-b152-4a12-bcf1-69186d6bb510/", "display_title": "Tomoko Yamada"}], "@type": ["Lab", "Item"], "display_title": "Tomoko Yamada, NW", "@id": "/labs/tomoko-yamada-lab/", "pi": {"error": "no view permissions"}, "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin", "role.lab_submitter", "submits_for.4e87e04c-6a49-4a71-8240-5fdae2f04b24"]}}, "award": {"display_title": "MECHANISMS OF GENOME ORGANIZATION IN BRAIN DEVELOPMENT AND BEHAVIOR", "uuid": "cf1cc388-e816-4061-b354-61bc4f8a23f8", "status": "current", "@id": "/awards/1U01DA053691-01/", "project": "4DN", "@type": ["Award", "Item"], "description": "NI-OFHHD: The long-term goals of the proposed research are to elucidate mechanisms of three-dimensional genome architecture in the control of neuronal connectivity in the brain. It has recently been found that physiological stimuli including sensory experience or developmental signals remodel neuronal genome architecture in vivo. Strikingly, it's found that long-distance genome interactions massively increase in the developing cerebellum in mice. The discovery of these long-distance interactions formed between genes critical for neuronal differentiation unveils novel nuclear mechanisms by which genome architecture may play a role in the wiring of the brain. These findings raise fundamental questions on the mechanisms and biological functions of these interactions in the brain, which will be addressed in this grant. First, the organizing principles of long-distance genome interactions in the brain will be elucidated. Based on the in vivo findings, the hypothesis that long-distance genomic interactions are organized by specific epigenetic and transcriptional features will be tested. In addition, the study will also test the hypothesis that anchors of long-distance interactions assemble into higher-ordered subnuclear structures including nuclear speckles or Mediator condensates, which function as transcriptionally active hubs. Second, the projcet will define mechanisms by which long-distance interactions are formed in development. The BAF chromatin remodeling complex alters the genome environment to activate or repress transcription and is required for brain development in mice and humans, and its dysregulation results in human neurodevelopmental disorders, including Coffin\u2013Siris syndrome and autism. Based on our preliminary findings, the hypothesis that the BAF complex transiently inhibits formation of long-distance genome interactions in immature neurons of the developing brain will be tested. Following early development, the inhibition of the long-distance interactions might be relieved by the recruitment of specific sets of transcription factors that drive terminal neuron differentiation. This project will test the hypothesis that these transcription regulators, identified using DNA motif analyses, promote the formation of the long-distance genome interactions. Finally, this study will also test the hypothesis that the formation of long-distance genome interactions is necessary for the maturation of neurons in vivo, including making proper connections with their pre- and post-synaptic partners. The proposed research is significant as it will advance our understanding of the mechanisms regulating genome architecture to control neuronal differentiation in mammalian brain. Furthermore, these studies will provide an integrated view on how genome folding in the nucleus orchestrates the assembly of neural circuits underlying behavior.", "name": "1U01DA053691-01", "center_title": "Yamada", "pi": {"error": "no view permissions"}, "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}, "status": "released", "aliases": ["yamada-lab:Lmna-sgRNA-Crispr-kd"], "guide_rnas": ["AGGCCCTCCTCTACAGGGGG", "GCGCACCTCGGGATCTGGGT"], "description": "dCas9 sgRNA-mediated knockdown of Lmna by targeting a region of the promoter", "date_created": "2024-02-15T21:03:52.604994+00:00", "submitted_by": {"error": "no view permissions"}, "last_modified": {"modified_by": {"error": "no view permissions"}, "date_modified": "2025-01-29T19:37:13.593862+00:00"}, "target_of_mod": [{"status": "released", "@type": ["BioFeature", "Item"], "display_title": "Lmna mouse gene", "uuid": "4b2ad421-0d62-4669-939c-5e24ab3f3713", "@id": "/bio-features/4b2ad421-0d62-4669-939c-5e24ab3f3713/", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}], "genomic_change": "disruption", "public_release": "2025-01-29", "schema_version": "2", "project_release": "2024-03-07", "modification_type": "Crispr", "@id": "/modifications/05643d1d-c693-492b-8949-bd0fccdcd632/", "@type": ["Modification", "Item"], "uuid": "05643d1d-c693-492b-8949-bd0fccdcd632", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}, "display_title": "Crispr disruption for Lmna mouse gene", "external_references": [], "modification_name": "Crispr disruption for Lmna mouse gene", "modification_name_short": "Lmna disruption", "@context": "/terms/", "aggregated-items": {}, "validation-errors": []}