{"lab": {"status": "current", "title": "Effie Apostolou, CORNELL", "correspondence": [{"contact_email": "ZWZhcG9zdG9sb3VAZ21haWwuY29t", "@id": "/users/9c7b948f-bc3e-40ee-8e23-c42b30268d03/", "display_title": "Effie Apostolou"}], "@type": ["Lab", "Item"], "@id": "/labs/effie-apostolou-lab/", "display_title": "Effie Apostolou, CORNELL", "uuid": "25604a5f-772b-43e2-a004-136ce41d0090", "pi": {"error": "no view permissions"}, "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin", "role.lab_submitter", "submits_for.25604a5f-772b-43e2-a004-136ce41d0090"]}}, "award": {"uuid": "8432a44c-4da7-446b-9080-f4fae299ebd6", "@type": ["Award", "Item"], "display_title": "DISCOVERY OF DIABETES-RELEVANT BETA CELL ENHANCERS THROUGH 4D ENHANCER MAPPING, INTEGRATIVE ANALYSIS, AND LARGE-SCALE CRISPRI PERTURBATION SCREENS", "center_title": "OFHHD - Huangfu", "project": "4DN", "@id": "/awards/1U01DK128852-01/", "description": "OFHHD: Enhancers are essential regulatory elements that together with transcription factors (TFs) instruct cell- type specific transcriptional programs during development, tissue homeostasis and regeneration. Initiatives such as the ENCODE project, revealed tens of thousands putative enhancers based on linear proximity, using criteria like chromatin accessibility, TF binding, and histone modifications such as H3K27ac. However, a main challenge of uncovering functional enhancers and assigning them to target genes lies in the complexity of the 3D chromatin organization, which can influence enhancer specificity and activity. Using an advanced chromosome conformation capture assay, we recently captured the dynamic rewiring of 3D enhancer networks during mouse somatic cell reprogramming and discovered multi-connected enhancers that we named \u201c3D enhancer hubs\u201d. Here we extend the 3D mapping approach to human primary islets, and compare islets from healthy and type 2 diabetes (T2D) donors to assemble a 4D atlas to capture the rewiring of 3D enhancer network in disease progression. At the same time, we plan to compare the enhancer network in adult islets to earlier stages of development by using human pluripotent stem cells (hPSCs) to generate early \u03b2 cells and their developmental precursors. Utilizing these 4D genomic data, we will computationally nominate core \u03b2-cell specific enhancers relevant to \u03b2 cell development, function, and T2D, and then interrogate these putative enhancers through large-scale CRISPRi mediated perturbation screens using hPSC-\u03b2 cells. Enhancers identified from the screening effort will be further validated in an established human \u03b2 cell line and primary human islet \u03b2 cells. This proposal addresses a critical gap in the 4DN initiative, that is how to translate 3D genomics data into functional data with respect to gene expression in the context of human health. Successful completion of our aims will establish a paradigm for the discovery and interrogation of functional enhancers that instruct transcriptional programs specific to a cell type of interest, reveal unique insights into their mechanisms of action, and identify enhancers with relevance to human development and disease. For instance, uncovering functional enhancers could assist the identification of noncoding causal variants identified in genome-wide association studies.", "name": "1U01DK128852-01", "status": "current", "pi": {"error": "no view permissions"}, "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}, "files": [{"file_type_detailed": "reads (fastq)", "dbxrefs": ["SRA:SRR21497060"], "file_size": 223112560, "file_type": "reads", "status": "released", "@id": "/files-fastq/4DNFI2FTOA4Q/", "file_classification": "raw file", "display_title": "4DNFI2FTOA4Q.fastq.gz", "upload_key": "b6e20788-b292-4e35-8096-dab6a2a02b29/4DNFI2FTOA4Q.fastq.gz", "@type": ["FileFastq", "File", "Item"], "uuid": "b6e20788-b292-4e35-8096-dab6a2a02b29", "href": "/files-fastq/4DNFI2FTOA4Q/@@download/4DNFI2FTOA4Q.fastq.gz", "accession": "4DNFI2FTOA4Q", "quality_metric": {"@type": ["QualityMetricFastqc", "QualityMetric", "Item"], "display_title": "QualityMetricFastqc from 2024-02-28", "uuid": "28e6bea8-52c0-4eb5-8b1c-274d7a2d4689", "overall_quality_status": "PASS", "@id": "/quality-metrics-fastqc/28e6bea8-52c0-4eb5-8b1c-274d7a2d4689/", "url": "https://s3.amazonaws.com/elasticbeanstalk-fourfront-webprod-wfoutput/4DNFI2FTOA4Q/fastqc_report.html", "status": "released", "Sequence length": "101", "Total Sequences": 16634487, "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}, "external_references": [{"ref": "SRA:SRR21497060", "uri": "https://www.ncbi.nlm.nih.gov/sra/?term=SRR21497060"}], "file_format": {"display_title": "fastq", "@type": ["FileFormat", "Item"], "status": "released", "file_format": "fastq", "@id": "/file-formats/fastq/", "uuid": "c13d06cf-218e-4f61-aaf0-91f226248b2c", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}, "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}], "status": "released", "aliases": ["effie-apostolou-lab:exp_4cseq_xen_pdgfa_mouse_B2_T1"], "dbxrefs": ["GEO:GSM6568207"], "protocol": {"status": "released", "uuid": "2bc65e81-a316-4769-a538-fe167429a512", "@id": "/protocols/2bc65e81-a316-4769-a538-fe167429a512/", "display_title": "4C Experimental protocol", "@type": ["Protocol", "Item"], "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}, "accession": "4DNEXUZ6VXI6", "biosample": {"@id": "/biosamples/4DNBSQD82BLC/", "status": "released", "accession": "4DNBSQD82BLC", "modifications_summary": "None", "biosource_summary": "extraembryonic cell", "display_title": "4DNBSQD82BLC", "uuid": "f123fc27-2aa0-40d9-9754-eeeffd918675", "treatments_summary": "None", "@type": ["Biosample", "Item"], "biosample_type": "stem cells", "biosource": [{"lab": {"status": "current", "@id": "/labs/4dn-dcic-lab/", "display_title": "4DN DCIC, HMS", "uuid": "828cd4fe-ebb0-4b36-a94a-d2e3a36cc989", "@type": ["Lab", "Item"], "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin", "role.lab_submitter", "submits_for.828cd4fe-ebb0-4b36-a94a-d2e3a36cc989"]}}, "award": {"@type": ["Award", "Item"], "@id": "/awards/2U01CA200059-06/", "status": "current", "display_title": "4D NUCLEOME NETWORK DATA COORDINATION AND INTEGRATION CENTER - PHASE II", "uuid": "71171a4e-dca1-44cb-8375-fafd896c6923", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}, "status": "released", "tissue": {"term_id": "CL:0000034", "uuid": "082f5be3-3617-4d3e-9ee9-78df53a71802", "slim_terms": [{"@type": ["OntologyTerm", "Item"], "display_title": "cell", "uuid": "72e16a19-eef3-46ca-a1b8-20e646e69675", "status": "current", "@id": "/ontology-terms/GO:0005623/", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}, {"@type": ["OntologyTerm", "Item"], "display_title": "cell", "uuid": "45d2b02e-130b-40db-8bf2-2288c6c57dcf", "status": "released", "@id": "/ontology-terms/CL:0000000/", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}], "status": "released", "preferred_name": "stem cell", "@id": "/ontology-terms/CL:0000034/", "term_name": "stem cell", "synonyms": ["animal stem cell"], "display_title": "stem cell", "@type": ["OntologyTerm", "Item"], "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}, "aliases": ["effie-apostolou-lab:xen_cell_line"], "accession": "4DNSRJ9J5AZZ", "cell_line": {"slim_terms": [{"status": "released", "@type": ["OntologyTerm", "Item"], "display_title": "cell", "@id": "/ontology-terms/CL:0000000/", "uuid": "45d2b02e-130b-40db-8bf2-2288c6c57dcf", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}, {"status": "released", "@type": ["OntologyTerm", "Item"], "display_title": "extraembryonic structure", "@id": "/ontology-terms/UBERON:0000478/", "uuid": "111150bc-8535-4448-903e-854af460a233", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}, {"status": "current", "@type": ["OntologyTerm", "Item"], "display_title": "cell", "@id": "/ontology-terms/GO:0005623/", "uuid": "72e16a19-eef3-46ca-a1b8-20e646e69675", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}], "term_name": "extraembryonic cell", "@id": "/ontology-terms/CL:0000349/", "status": "released", "term_id": "CL:0000349", "preferred_name": "extraembryonic cell", "uuid": "943e3093-be7a-4447-abdf-1f7651873b0b", "synonyms": ["extra-embryonic cell"], "@type": ["OntologyTerm", "Item"], "display_title": "extraembryonic cell", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}, "individual": {"@type": ["IndividualMouse", "Individual", "Item"], "display_title": "4DNINLEHBCFV", "status": "released", "uuid": "6e5a14ce-dd01-4b8b-84d9-8bf75adb0cb0", "@id": "/individuals-mouse/4DNINLEHBCFV/", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}, "description": "eXtraEmbryonic ENdoderm cells (XEN) from mouse (IM8A1 )", "date_created": "2023-11-09T15:17:31.630975+00:00", "submitted_by": {"error": "no view permissions"}, "last_modified": {"modified_by": {"error": "no view permissions"}, "date_modified": "2024-04-05T17:52:48.355724+00:00"}, "biosource_type": "stem cell", "cell_line_tier": "Unclassified", "public_release": "2024-04-05", "schema_version": "2", "project_release": "2024-04-05", "@id": "/biosources/4DNSRJ9J5AZZ/", "@type": ["Biosource", "Item"], "uuid": "d1476202-461a-4a26-a955-c9c68154f6d8", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}, "display_title": "extraembryonic cell - 4DNSRJ9J5AZZ", "external_references": [], "biosource_name": "extraembryonic cell", "biosource_category": ["Mouse stem cell"], "organism": {"@id": "/organisms/10090/", "display_title": "M. musculus", "@type": ["Organism", "Item"], "name": "mouse", "status": "released", "uuid": "3413218c-3d86-498b-a0a2-9a406638e786", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}}], "badges": [{"messages": ["Biosample missing morphology_image"], "badge": {"warning": "Biosample Metadata Incomplete", "@id": "/badges/biosample-metadata-incomplete/", "uuid": "2b2cc7ff-b7a8-4138-9a6c-22884fc71690", "badge_icon": "/static/img/badges/biosample-icon.svg", "description": "Biosample is missing metadata information required as part of the standards implemented by the 4DN Samples working group.", "@type": ["Badge", "Item"], "display_title": "Biosample Metadata Incomplete", "status": "released", "badge_classification": "Warning", "title": "Biosample Metadata Incomplete", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}}], "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}, "pcr_cycles": 36, "description": "4C-seq on Extra embryonic stem cells (XEN) from mouse - Pdgfa - Biological replicate 2, Technical replicate 1", "sop_mapping": {"has_sop": "No"}, "date_created": "2023-12-04T19:33:52.442539+00:00", "submitted_by": {"error": "no view permissions"}, "last_modified": {"modified_by": {"error": "no view permissions"}, "date_modified": "2024-04-05T17:48:07.282193+00:00"}, "ligation_time": 480.0, "round2_enzyme": {"display_title": "CviQI", "@id": "/enzymes/CviQI/", "@type": ["Enzyme", "Item"], "status": "released", "uuid": "77221626-8581-4e8f-a406-bebbf7656a11", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}, "digestion_time": 480.0, "public_release": "2024-04-05", "schema_version": "3", "experiment_type": {"status": "released", "assay_subclass_short": "Enrichment Hi-C", "@type": ["ExperimentType", "Item"], "display_title": "4C-seq", "@id": "/experiment-types/4c-seq/", "title": "4C-seq", "experiment_category": "Sequencing", "uuid": "14ff7283-5663-4cde-a9e9-41262b4bd519", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}, "ligation_volume": 575.0, "project_release": "2024-04-05", "digestion_enzyme": {"status": "released", "display_title": "DpnII", "uuid": "356a57a1-1f1d-463d-a972-27742f79a6a5", "name": "DpnII", "@id": "/enzymes/DpnII/", "@type": ["Enzyme", "Item"], "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}, "targeted_regions": [{"target": [{"display_title": "Pdgfa mouse gene", "@id": "/bio-features/7a08adb7-92b4-4fcc-9fb9-af5177bb1203/", "uuid": "7a08adb7-92b4-4fcc-9fb9-af5177bb1203", "organism_name": "mouse", "feature_type": {"uuid": "0231da78-1adc-4b8a-89b9-4f91908412a3", "@type": ["OntologyTerm", "Item"], "display_title": "gene", "@id": "/ontology-terms/SO:0000704/", "status": "released", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}, "status": "released", "@type": ["BioFeature", "Item"], "relevant_genes": [{"geneid": "18590", "@type": ["Gene", "Item"], "preferred_symbol": "Pdgfa", "display_title": "Pdgfa", "@id": "/genes/18590/", "uuid": "d862977a-0ce4-4800-bb2e-13da2e6fb6f3", "status": "released", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}], "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}], "target_primer": "TACACGACGCTCTTCCGATCTGACTTGGGCTTGGGCCTGG"}], "crosslinking_time": 10.0, "biosample_quantity": 10000000.0, "crosslinking_method": "1% Formaldehyde", "fragment_size_range": "300-700", "ligation_temperature": 16.0, "average_fragment_size": 500, "digestion_temperature": 37.0, "biosample_quantity_units": "cells", "crosslinking_temperature": 25.0, "library_preparation_date": "2022-02-23", "@id": "/experiments-capture-c/4DNEXUZ6VXI6/", "@type": ["ExperimentCaptureC", "Experiment", "Item"], "uuid": "d614ccf5-e023-4a24-a233-38b759eb8433", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}, "display_title": "4C-seq on extraembryonic cell with DpnII - 4DNEXUZ6VXI6", "external_references": [{"ref": "GEO:GSM6568207", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM6568207"}], "experiment_sets": [{"@id": "/experiment-set-replicates/4DNESG58ZWOV/", "accession": "4DNESG58ZWOV", "display_title": "4DNESG58ZWOV", "status": "released", "experimentset_type": "replicate", "@type": ["ExperimentSetReplicate", "ExperimentSet", "Item"], "uuid": "ce73829d-8592-4b1c-bab6-0209cffe4b37", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}], "produced_in_pub": {"short_attribution": "Murphy D et al. (2023)", "status": "current", "ID": "doi:10.1101/2023.07.19.549714", "authors": ["Murphy D", "Salataj E", "Di Giammartino DC", "Rodriguez-Hernaez J", "Kloetgen A", "Garg V", "Char E", "Uyehara CM", "Ee LS", "Lee U", "Stadtfeld M", "Hadjantonakis AK", "Tsirigos A", "Polyzos A", "Apostolou E"], "@id": "/publications/97a0f850-b5a9-4994-b2eb-a24c706ae6b3/", "title": "Systematic mapping and modeling of 3D enhancer-promoter interactions in early  mouse embryonic lineages reveal regulatory principles that determine the levels  and cell-type specificity of gene expression.", "uuid": "97a0f850-b5a9-4994-b2eb-a24c706ae6b3", "display_title": "Murphy D et al. (2023) doi:10.1101/2023.07.19.549714", "journal": "bioRxiv : the preprint server for biology", "@type": ["Publication", "Item"], "abstract": "Mammalian embryogenesis commences with two pivotal and binary cell fate decisions  that give rise to three essential lineages, the trophectoderm (TE), the epiblast  (EPI) and the primitive endoderm (PrE). Although key signaling pathways and  transcription factors that control these early embryonic decisions have been  identified, the non-coding regulatory elements via which transcriptional  regulators enact these fates remain understudied. To address this gap, we have  characterized, at a genome-wide scale, enhancer activity and 3D connectivity in  embryo-derived stem cell lines that represent each of the early developmental  fates. We observed extensive enhancer remodeling and fine-scale 3D chromatin  rewiring among the three lineages, which strongly associate with transcriptional  changes, although there are distinct groups of genes that are irresponsive to  topological changes. In each lineage, a high degree of connectivity or \"hubness\"  positively correlates with levels of gene expression and enriches for cell-type  specific and essential genes. Genes within 3D hubs also show a significantly  stronger probability of coregulation across lineages, compared to genes in linear  proximity or within the same contact domains. By incorporating 3D chromatin  features, we build a novel predictive model for transcriptional regulation  (3D-HiChAT), which outperformed models that use only 1D promoter or proximal  variables in predicting levels and cell-type specificity of gene expression.  Using 3D-HiChAT, we performed genome-wide in silico perturbations to nominate  candidate functional enhancers and hubs in each cell lineage, and with CRISPRi  experiments we validated several novel enhancers that control expression of one  or more genes in their respective lineages. Our study comprehensively identifies  3D regulatory hubs associated with the earliest mammalian lineages and describes  their relationship to gene expression and cell identity, providing a framework to  understand lineage-specific transcriptional behaviors.", "date_published": "2023-07-19", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}, "publications_of_exp": [{"uuid": "97a0f850-b5a9-4994-b2eb-a24c706ae6b3", "abstract": "Mammalian embryogenesis commences with two pivotal and binary cell fate decisions  that give rise to three essential lineages, the trophectoderm (TE), the epiblast  (EPI) and the primitive endoderm (PrE). Although key signaling pathways and  transcription factors that control these early embryonic decisions have been  identified, the non-coding regulatory elements via which transcriptional  regulators enact these fates remain understudied. To address this gap, we have  characterized, at a genome-wide scale, enhancer activity and 3D connectivity in  embryo-derived stem cell lines that represent each of the early developmental  fates. We observed extensive enhancer remodeling and fine-scale 3D chromatin  rewiring among the three lineages, which strongly associate with transcriptional  changes, although there are distinct groups of genes that are irresponsive to  topological changes. In each lineage, a high degree of connectivity or \"hubness\"  positively correlates with levels of gene expression and enriches for cell-type  specific and essential genes. Genes within 3D hubs also show a significantly  stronger probability of coregulation across lineages, compared to genes in linear  proximity or within the same contact domains. By incorporating 3D chromatin  features, we build a novel predictive model for transcriptional regulation  (3D-HiChAT), which outperformed models that use only 1D promoter or proximal  variables in predicting levels and cell-type specificity of gene expression.  Using 3D-HiChAT, we performed genome-wide in silico perturbations to nominate  candidate functional enhancers and hubs in each cell lineage, and with CRISPRi  experiments we validated several novel enhancers that control expression of one  or more genes in their respective lineages. Our study comprehensively identifies  3D regulatory hubs associated with the earliest mammalian lineages and describes  their relationship to gene expression and cell identity, providing a framework to  understand lineage-specific transcriptional behaviors.", "ID": "doi:10.1101/2023.07.19.549714", "short_attribution": "Murphy D et al. (2023)", "authors": ["Murphy D", "Salataj E", "Di Giammartino DC", "Rodriguez-Hernaez J", "Kloetgen A", "Garg V", "Char E", "Uyehara CM", "Ee LS", "Lee U", "Stadtfeld M", "Hadjantonakis AK", "Tsirigos A", "Polyzos A", "Apostolou E"], "journal": "bioRxiv : the preprint server for biology", "date_published": "2023-07-19", "status": "current", "@id": "/publications/97a0f850-b5a9-4994-b2eb-a24c706ae6b3/", "display_title": "Murphy D et al. (2023) doi:10.1101/2023.07.19.549714", "title": "Systematic mapping and modeling of 3D enhancer-promoter interactions in early  mouse embryonic lineages reveal regulatory principles that determine the levels  and cell-type specificity of gene expression.", "@type": ["Publication", "Item"], "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}], "experiment_categorizer": {"field": "Target", "value": "Pdgfa mouse gene", "combined": "Target: Pdgfa mouse gene"}, "experiment_summary": "4C-seq on extraembryonic cell with DpnII", "@context": "/terms/", "aggregated-items": {"badges": [{"parent": "/biosamples/4DNBSQD82BLC/", "embedded_path": "biosample.badges", "item": {"messages": ["Biosample missing morphology_image"], "badge": {"commendation": null, "warning": "Biosample Metadata Incomplete", "uuid": "2b2cc7ff-b7a8-4138-9a6c-22884fc71690", "@id": "/badges/biosample-metadata-incomplete/", "badge_icon": "/static/img/badges/biosample-icon.svg", "description": "Biosample is missing metadata information required as part of the standards implemented by the 4DN Samples working group."}}}]}, "validation-errors": []}